Stem-loop sequence hsa-mir-423

AccessionMI0001445
Symbol HGNC:MIR423
DescriptionHomo sapiens miR-423 stem-loop
Gene family MIPF0000329; mir-423
Stem-loop
   -----auaa       u            -ag   g    a     cua 
5'          aggaagu aggcugaggggc   aga cgag cuuuu   u
            ||||||| ||||||||||||   ||| |||| |||||   u
3'          uccuucg ucugacuccccg   ucu gcuc gaaaa   u
   cgcgcccaa       u            gag   g    -     ccu 
Get sequence
Deep sequencing
167693 reads, 8.78e+03 reads per million, 80 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

miR-423 (renamed miR-423-3p here) is expressed in human promyelocytic leukemia (HL-60) cells [1]. The level of expression was shown to be up-regulated 48 hours after TPA-induction. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2].

Genome context
Coordinates (GRCh38) Overlapping transcripts
chr17: 30117079-30117172 [+]
intergenic
Clustered miRNAs
< 10kb from hsa-mir-423
hsa-mir-423chr17: 30117079-30117172 [+]
hsa-mir-3184chr17: 30117086-30117160 [-]
Database links

Mature sequence hsa-miR-423-5p

Accession MIMAT0004748
Sequence

17 - 

ugaggggcagagagcgagacuuu

 - 39

Get sequence
Deep sequencing37917 reads, 68 experiments
Evidence experimental; cloned [2-4], Northern [4], Illumina [5]
Predicted targets

Mature sequence hsa-miR-423-3p

Accession MIMAT0001340
Previous IDshsa-miR-423
Sequence

53 - 

agcucggucugaggccccucagu

 - 75

Get sequence
Deep sequencing30137 reads, 66 experiments
Evidence experimental; cloned [1-2], Northern [1]
Validated targets
Predicted targets

References

1
PMID:15325244 "Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells" Kasashima K, Nakamura Y, Kozu T Biochem Biophys Res Commun. 322:403-410(2004).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).
4
PMID:18230126 "New miRNAs cloned from neuroblastoma" Afanasyeva EA, Hotz-Wagenblatt A, Glatting KH, Westermann F BMC Genomics. 9:52(2008).
5