Stem-loop sequence hsa-mir-422a

Accession MI0001444
Symbol HGNC:MIR422A
Description Homo sapiens miR-422a stem-loop
Gene family MIPF0000548; mir-422
Stem-loop 
-----   --a     ac   a       u    ag    ga    - uc 
     gag   gaagc  ugg cuuaggg caga  gccu  gucu c  u
     |||   |||||  ||| ||||||| ||||  ||||  |||| |   
     cuc   uuucg  acc gaguccc gucu  cggg  uaga g  g
ggucc   cug     -a   -       u    cu    --    c uc
Get sequence
Deep sequencing
474 reads, 12 experiments
Comments

miR-422a is an predicted paralogue of miR-422b (MI0001443 ), later verified in human [2].

Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr15: 64163129-64163218 [-]
intergenic
Database links

Mature sequence hsa-miR-422a

Accession MIMAT0001339
Sequence

10 -  

acuggacuuagggucagaaggc

 - 31

Get sequence
Deep sequencing 474 reads, 12 experiments
Evidence experimental; cloned [2]
Validated targets
Predicted targets

References

1
PMID:15325244 "Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells" Kasashima K, Nakamura Y, Kozu T Biochem Biophys Res Commun. 322:403-410(2004).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).