Stem-loop sequence osa-MIR419

AccessionMI0001439 (change log)
DescriptionOryza sativa miR419 stem-loop
Literature search

5 open access papers mention osa-MIR419
(6 sentences)

Stem-loop
   ucu   - -ugu      u  ug -au  ugacgau  ug      ----u   cuu 
5'    ucu c    ucucug ga  a   gc       gu  uagaug     gaa   u
      ||| |    |||||| ||  |   ||       ||  ||||||     |||    
3'    aga g    agaggu cu  u   cg       ua  aucugu     cuu   u
   ---   u uuau      c  gu guu  ---uaag  gu      ugucu   uuu 
Get sequence
Deep sequencing
1 reads, 0 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

The status of this sequence as a miRNA has been questioned on the basis of lack of conservation in genomes other than Arabidopsis and rice, moderately poor precursor hairpin structure, lack of identified targets, and low Northern blot signal [2]. This sequence may therefore be removed in subsequent data releases.

Genome context
Coordinates (MSU7) Overlapping transcripts
Chr12: 8237520-8237622 [-]
intergenic
Database links

Mature sequence osa-miR419

Accession MIMAT0001335
Sequence

17 - 

ugaugaaugcugacgauguug

 - 37

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence by similarity; MI0001430

References

1
PMID:15345049 "Prediction and identification of Arabidopsis thaliana microRNAs and their mRNA targets" Wang XJ, Reyes JL, Chua NH, Gaasterland T Genome Biol. 5:R65(2004).
2
PMID:16669754 "MicroRNAS and their regulatory roles in plants" Jones-Rhoades MW, Bartel DP, Bartel B Annu Rev Plant Biol. 57:19-53(2006).