Stem-loop sequence osa-MIR418

AccessionMI0001438 (change log)
DescriptionOryza sativa miR418 stem-loop
Literature search

5 open access papers mention osa-MIR418
(5 sentences)

Stem-loop
   c  u  -  gucu   -auc   --    c           ca 
5'  gu ag cu    gca    ugc  cauu uuaucaucgca  u
    || || ||    |||    |||  |||| |||||||||||  u
3'  ca uc ga    ugu    acg  guaa aguaguagugu  u
   c  c  u  --ac   cuuu   ca    -           aa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

The status of this sequence as a miRNA has been questioned on the basis of lack of conservation in genomes other than Arabidopsis and rice, moderately poor precursor hairpin structure, lack of identified targets, and low Northern blot signal [2]. This sequence may therefore be removed in subsequent data releases.

Genome context
Coordinates (MSU7) Overlapping transcripts
Chr2: 35182622-35182703 [-]
intergenic
Database links

Mature sequence osa-miR418

Accession MIMAT0001334
Sequence

42 - 

uaaugugaugaugaaaugacg

 - 62

Get sequence
Evidence by similarity; MI0001429

References

1
PMID:15345049 "Prediction and identification of Arabidopsis thaliana microRNAs and their mRNA targets" Wang XJ, Reyes JL, Chua NH, Gaasterland T Genome Biol. 5:R65(2004).
2
PMID:16669754 "MicroRNAS and their regulatory roles in plants" Jones-Rhoades MW, Bartel DP, Bartel B Annu Rev Plant Biol. 57:19-53(2006).