Stem-loop sequence osa-MIR416

AccessionMI0001436 (change log)
DescriptionOryza sativa miR416 stem-loop
Literature search

4 open access papers mention osa-MIR416
(6 sentences)

Stem-loop
         g   ------       gaa    u    --     uac   gg  g   a    
5' gaugag agu      augaaua   agaa uaga  aaagc   ggu  uu uug gca 
   |||||| |||      |||||||   |||| ||||  |||||   |||  || ||| || g
3' cuacuu uca      ugcuugu   ucuu gucu  uuucg   uca  aa aac cgc 
         g   caugcc       --g    u    cg     -uc   aa  a   -    
Get sequence
Deep sequencing
5 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

The status of this sequence as a miRNA has been questioned on the basis of lack of conservation in genomes other than Arabidopsis and rice, moderately poor precursor hairpin structure, lack of identified targets, and low Northern blot signal [2]. This sequence may therefore be removed in subsequent data releases.

Genome context
Coordinates (MSU7) Overlapping transcripts
Chr4: 17456166-17456274 [+]
intergenic
Database links

Mature sequence osa-miR416

Accession MIMAT0001332
Sequence

87 - 

uguucguccguacacuguuca

 - 107

Get sequence
Evidence by similarity; MI0001427

References

1
PMID:15345049 "Prediction and identification of Arabidopsis thaliana microRNAs and their mRNA targets" Wang XJ, Reyes JL, Chua NH, Gaasterland T Genome Biol. 5:R65(2004).
2
PMID:16669754 "MicroRNAS and their regulatory roles in plants" Jones-Rhoades MW, Bartel DP, Bartel B Annu Rev Plant Biol. 57:19-53(2006).