Stem-loop sequence osa-MIR414

AccessionMI0001434 (change log)
DescriptionOryza sativa miR414 stem-loop
Literature search

15 open access papers mention osa-MIR414
(42 sentences)

Stem-loop
         g  g   u --a     a  au a  g     g augaaa    ca    a 
5' guugcc cu ccg c   uccuc uc  c uc uccuu c      ccgc  gcaa u
   |||||| || ||| |   ||||| ||  | || ||||| |      ||||  ||||  
3' cggcgg ga ggc g   agggg ag  g ag gggag g      ggcg  cguu c
         g  -   u ggg     g  gg a  g     g -----g    --    c 
Get sequence
Deep sequencing
10 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

The status of this sequence as a miRNA has been questioned on the basis of lack of conservation in genomes other than Arabidopsis and rice, moderately poor precursor hairpin structure, lack of identified targets, and low Northern blot signal [2]. This sequence may therefore be removed in subsequent data releases.

Genome context
Coordinates (MSU7) Overlapping transcripts
Chr11: 15504891-15504996 [+]
intergenic
Database links

Mature sequence osa-miR414

Accession MIMAT0001330
Sequence

14 - 

ucauccucaucaucaucgucc

 - 34

Get sequence
Evidence by similarity; MI0001425

References

1
PMID:15345049 "Prediction and identification of Arabidopsis thaliana microRNAs and their mRNA targets" Wang XJ, Reyes JL, Chua NH, Gaasterland T Genome Biol. 5:R65(2004).
2
PMID:16669754 "MicroRNAS and their regulatory roles in plants" Jones-Rhoades MW, Bartel DP, Bartel B Annu Rev Plant Biol. 57:19-53(2006).