Stem-loop sequence ath-MIR415

AccessionMI0001426 (change log)
DescriptionArabidopsis thaliana miR415 stem-loop
Literature search

1 open access papers mention ath-MIR415
(1 sentences)

Stem-loop
      ac     a     --       auauucucugucuuuuuuuguggcaaaagu 
5' aga  agagc gaaac  agaacau                              a
   |||  ||||| |||||  |||||||                               
3' ucu  ucucg uuuug  ucuugua                              a
      cu     a     gu       agcuaccauuuucucaacagaagagcggua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

The status of this sequence as a miRNA has been questioned on the basis of lack of conservation in genomes other than Arabidopsis and rice, moderately poor precursor hairpin structure, lack of identified targets, and low Northern blot signal [2]. This sequence may therefore be removed in subsequent data releases.

Genome context
Coordinates (TAIR10; GCA_000001735.1) Overlapping transcripts
chr1: 27987016-27987125 [+]
intergenic
Database links

Mature sequence ath-miR415

Accession MIMAT0001323
Sequence

3 - 

aacagagcagaaacagaacau

 - 23

Get sequence
Evidence experimental; Northern [1]

References

1
PMID:15345049 "Prediction and identification of Arabidopsis thaliana microRNAs and their mRNA targets" Wang XJ, Reyes JL, Chua NH, Gaasterland T Genome Biol. 5:R65(2004).
2
PMID:16669754 "MicroRNAS and their regulatory roles in plants" Jones-Rhoades MW, Bartel DP, Bartel B Annu Rev Plant Biol. 57:19-53(2006).