Stem-loop sequence cbr-mir-84

AccessionMI0001413 (change log)
DescriptionCaenorhabditis briggsae miR-84 stem-loop
Gene family MIPF0000250; mir-84
Stem-loop
   uugcuauauauucagccguacugucugaaaau    u      u    u c    c   c   guaa 
5'                                 aaca cugagg aguu g aaug ugu gac    c
                                   |||| |||||| |||| | |||| ||| |||    u
3'                                 uugu ggcucc ucaa c uuac aca cug    g
   ----------------------aucggaaaac    c      u    c -    u   a   aaaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This miRNA is the predicted homologue of a verified C. elegans miRNA [1]. Its expression has not been verified in C. briggsae. The mature sequence differs from the elegans sequence at 4 positions.

Genome context
Coordinates (CB4; GCA_000004555.3) Overlapping transcripts
chrX: 796067-796180 [-]
intergenic
Database links

Mature sequence cbr-miR-84

Accession MIMAT0001311
Sequence

39 - 

ugagguaguuugcaaugcuguc

 - 60

Get sequence
Evidence by similarity; MI0000055

References

1
PMID:12672692 "The microRNAs of Caenorhabditis elegans" Lim LP, Lau NC, Weinstein EG, Abdelhakim A, Yekta S, Rhoades MW, Burge CB, Bartel DP Genes Dev. 17:991-1008(2003).