Stem-loop sequence cbr-mir-240

AccessionMI0001408 (change log)
DescriptionCaenorhabditis briggsae miR-240 stem-loop
Gene family MIPF0000243; mir-240
Stem-loop
   cgcugucuuuauuuuga     -uu      u         c      u a    aa   c 
5'                  aacug   uucaaa cgagaauuu gaggcc g augc  gaa c
                    |||||   |||||| ||||||||| |||||| | ||||  |||  
3'                  uugau   aaguuu gcuuuuaaa cuccgg c uacg  uuu g
   ----------gugcgca     uuu      c         c      u a    ag   u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This miRNA is the predicted homologue of a verified C. elegans miRNA [1]. Its expression has not been verified in C. briggsae. The mature sequence differs from the elegans sequence at 2 positions.

Genome context
Coordinates (CB4; GCA_000004555.3) Overlapping transcripts
chrX: 13610687-13610799 [+]
intergenic
Clustered miRNAs
< 10kb from cbr-mir-240
cbr-mir-240chrX: 13610687-13610799 [+]
cbr-mir-786chrX: 13610815-13610905 [+]
Database links

Mature sequence cbr-miR-240

Accession MIMAT0001306
Sequence

72 - 

uacuggccuccaaauuuucgcu

 - 93

Get sequence
Evidence by similarity; MI0000316

References

1
PMID:12672692 "The microRNAs of Caenorhabditis elegans" Lim LP, Lau NC, Weinstein EG, Abdelhakim A, Yekta S, Rhoades MW, Burge CB, Bartel DP Genes Dev. 17:991-1008(2003).