Stem-loop sequence cbr-mir-61

AccessionMI0001404 (change log)
DescriptionCaenorhabditis briggsae miR-61 stem-loop
Gene family MIPF0000297; mir-61
Stem-loop
   ----------uacuuga      u       c         cuaa     c  -   g 
5'                  ucggug cucgagc gaguuaagg    uaguc uu ccg u
                    |||||| ||||||| |||||||||    ||||| || ||| g
3'                  agucau gagcucg cucaguucc    aucag aa ggu u
   cccgccccaguuucucg      u       u         -aag     u  u   a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This miRNA is the predicted homologue of a verified C. elegans miRNA [1]. Its expression has not been verified in C. briggsae. The mature sequence differs from the elegans sequence at 4 positions.

Genome context
Coordinates (CB4; GCA_000004555.3) Overlapping transcripts
chrV: 9339579-9339685 [-]
intergenic
Clustered miRNAs
< 10kb from cbr-mir-61
cbr-mir-61chrV: 9339579-9339685 [-]
cbr-mir-250chrV: 9339442-9339528 [-]
Database links

Mature sequence cbr-miR-61

Accession MIMAT0001302
Sequence

58 - 

ugacuagaaccuugacucugcuc

 - 80

Get sequence
Evidence by similarity; MI0000032

References

1
PMID:12672692 "The microRNAs of Caenorhabditis elegans" Lim LP, Lau NC, Weinstein EG, Abdelhakim A, Yekta S, Rhoades MW, Burge CB, Bartel DP Genes Dev. 17:991-1008(2003).