Stem-loop sequence cbr-mir-51

AccessionMI0001398 (change log)
DescriptionCaenorhabditis briggsae miR-51 stem-loop
Gene family MIPF0000268; mir-51
Stem-loop
   cgucaucgaaucucaacgucaaacggauccgaagacguccaucuacc          ---u       ua    uaa  g gaa 
5'                                                cguagcuccu    gccaugu  cugg   aa u   c
                                                  ||||||||||    |||||||  ||||   || |   a
3'                                                guauugagga    cgguaca  ggcc   uu a   u
   -----------------------uuagaacuuuggaguugugcagaa          ugac       ug    ugg  g agg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This miRNA is the predicted homologue of a verified C. elegans miRNA [1]. Its expression has not been verified in C. briggsae. The mature sequence differs from the elegans sequence at 2 positions.

Genome context
Coordinates (CB4; GCA_000004555.3) Overlapping transcripts
chrIV: 7366589-7366733 [+]
intergenic
Clustered miRNAs
< 10kb from cbr-mir-51
cbr-mir-52chrIV: 7363013-7363110 [+]
cbr-mir-51chrIV: 7366589-7366733 [+]
Database links

Mature sequence cbr-miR-51

Accession MIMAT0001297
Sequence

44 - 

uacccguagcuccuugccauguu

 - 66

Get sequence
Evidence by similarity; MI0000022

References

1
PMID:12672692 "The microRNAs of Caenorhabditis elegans" Lim LP, Lau NC, Weinstein EG, Abdelhakim A, Yekta S, Rhoades MW, Burge CB, Bartel DP Genes Dev. 17:991-1008(2003).