Stem-loop sequence dre-mir-223

AccessionMI0001389 (change log)
Previous IDsdre-mir-223;dre-mir-223-1
DescriptionDanio rerio miR-223 stem-loop
Gene family MIPF0000067; mir-223
Literature search

8 open access papers mention dre-mir-223
(51 sentences)

Stem-loop
   cucuccuccugaucuagacu        a a              gugguu       gau 
5'                     cuucucuu g guauuugacagacu      gacacuc   c
                       |||||||| | ||||||||||||||      |||||||   u
3'                     ggagagaa c cauaaacuguuuga      cuguggg   a
   --------------------        c c              ------       gaa 
Get sequence
Deep sequencing
2960 reads, 100 reads per million, 11 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr5: 22234407-22234505 [-]
intergenic
KZ115109.1: 217123-217221 [-]
intergenic
Database links

Mature sequence dre-miR-223

Accession MIMAT0001290
Sequence

71 - 

ugucaguuugucaaauacccc

 - 91

Get sequence
Deep sequencing2374 reads, 11 experiments
Evidence experimental; PCR [1]
Database links
Predicted targets

References

1
PMID:12624257 "Vertebrate microRNA genes" Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP Science. 299:1540(2003).