Stem-loop sequence dre-mir-219-2

AccessionMI0001385 (change log)
DescriptionDanio rerio miR-219-2 stem-loop
Gene family MIPF0000044; mir-219
Literature search

7 open access papers mention dre-mir-219-2
(23 sentences)

Stem-loop
   ---------------u   u     aa           ugaaa  -  g 
5'                 gau gucca  cgcaauucuug     ug uc a
                   ||| |||||  |||||||||||     || ||  
3'                 cua caggu  guguuaagagc     ac ag g
   ccucggaggucguugu   -     cc           ---ug  u  c 
Get sequence
Deep sequencing
925 reads, 28.6 reads per million, 7 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr5: 65101371-65101450 [+]
sense
OTTDART00000060002 ; si:ch211-233f10.7-001; exon 2
ENSDART00000154708 ; si:ch211-233f10.7-001; exon 2
KZ115158.1: 20010-20089 [+]
sense
OTTDART00000060002 ; si:ch211-233f10.7-001; exon 2
ENSDART00000154708 ; si:ch211-233f10.7-001; exon 2
Database links

Mature sequence dre-miR-219-5p

Accession MIMAT0001286
Previous IDsdre-miR-219
Sequence

1 - 

ugauuguccaaacgcaauucuu

 - 22

Get sequence
Deep sequencing890 reads, 5 experiments
Evidence experimental; cloned [1]
Database links
Predicted targets

References

1
PMID:12624257 "Vertebrate microRNA genes" Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP Science. 299:1540(2003).
2
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).