Stem-loop sequence dre-mir-214

AccessionMI0001381 (change log)
DescriptionDanio rerio miR-214 stem-loop
Gene family MIPF0000062; mir-214
Literature search

15 open access papers mention dre-mir-214
(198 sentences)

Stem-loop
   ugacuga a  -  ug               aca            aacuu 
5'        g gc gu  ucugucugccugucu   cuugcugugcag     c
          | || ||  |||||||||||||||   ||||||||||||      
3'        c cg cg  agacagacggacaga   ggacgacauguc     c
   ---uccg c  a  gu               cac            cacgu 
Get sequence
Deep sequencing
14522 reads, 1.05e+03 reads per million, 11 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr20: 14877639-14877738 [+]
antisense
OTTDART00000004875 ; dnm3-001; intron 15
ENSDART00000047039 ; dnm3-201; intron 14
ENSDART00000152641 ; dnm3-001; intron 15
Clustered miRNAs
< 10kb from dre-mir-214
dre-mir-199-1chr20: 14875460-14875546 [+]
dre-mir-214chr20: 14877639-14877738 [+]
Database links

Mature sequence dre-miR-214

Accession MIMAT0001283
Sequence

62 - 

acagcaggcacagacaggcag

 - 82

Get sequence
Deep sequencing13535 reads, 11 experiments
Evidence experimental; cloned [1-2]
Database links
Predicted targets

References

1
PMID:12624257 "Vertebrate microRNA genes" Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP Science. 299:1540(2003).
2
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).