Stem-loop sequence dre-mir-181a-1

AccessionMI0001380 (change log)
Previous IDsdre-mir-213
DescriptionDanio rerio miR-181a-1 stem-loop
Gene family MIPF0000007; mir-181
Literature search

18 open access papers mention dre-mir-181a-1
(68 sentences)

Stem-loop
   guuu   u   u a   u      cu       a    -gag  a 
5'     gcc cag g aca ucaacg  gucggug guuu    cu a
       ||| ||| | ||| ||||||  ||||||| ||||    ||  
3'     cgg guc c ugu aguugc  cagcuac caaa    gg a
   ----   c   c a   u      --       -    aaaa  u 
Get sequence
Deep sequencing
936025 reads, 5.99e+04 reads per million, 11 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr22: 22826004-22826087 [-]
intergenic
Clustered miRNAs
< 10kb from dre-mir-181a-1
dre-mir-181a-1chr22: 22826004-22826087 [-]
dre-mir-181b-3chr22: 22825793-22825877 [-]
Database links

Mature sequence dre-miR-181a-5p

Accession MIMAT0001623
Previous IDsdre-miR-181a
Sequence

14 - 

aacauucaacgcugucggugagu

 - 36

Get sequence
Deep sequencing4592586 reads, 11 experiments
Evidence by similarity; MI0001380

Mature sequence dre-miR-181a-3p

Accession MIMAT0001282
Previous IDsdre-miR-213;dre-miR-181a*
Sequence

56 - 

accaucgaccguugauuguacc

 - 77

Get sequence
Deep sequencing17500 reads, 11 experiments
Evidence experimental; cloned [1]
Database links

References

1
PMID:12624257 "Vertebrate microRNA genes" Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP Science. 299:1540(2003).