Stem-loop sequence dre-mir-205

AccessionMI0001378 (change log)
Previous IDsdre-mir-205;dre-mir-205-1
DescriptionDanio rerio miR-205 stem-loop
Gene family MIPF0000058; mir-205
Literature search

7 open access papers mention dre-mir-205
(28 sentences)

Stem-loop
   aaacua     ca     uc      u    c        --  uag 
5'       cugug  uucua  cuucau ccac ggagucug  ug   u
         |||||  |||||  |||||| |||| ||||||||  ||    
3'       ggcac  aggau  gaagug ggug cuuuagac  ac   u
   -----a     aa     gu      u    a        ua  uug 
Get sequence
Deep sequencing
382302 reads, 2.33e+04 reads per million, 11 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr23: 33290273-33290361 [+]
intergenic
Database links

Mature sequence dre-miR-205-5p

Accession MIMAT0001280
Previous IDsdre-miR-205
Sequence

19 - 

uccuucauuccaccggagucug

 - 40

Get sequence
Deep sequencing372888 reads, 11 experiments
Evidence experimental; cloned [1-2]
Database links
Predicted targets

Mature sequence dre-miR-205-3p

Accession MIMAT0031925
Sequence

57 - 

gauuucaguggugugaagugua

 - 78

Get sequence
Deep sequencing9398 reads, 11 experiments
Evidence not experimental
Database links

References

1
PMID:12624257 "Vertebrate microRNA genes" Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP Science. 299:1540(2003).
2
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).