Stem-loop sequence dre-mir-204-1

AccessionMI0001377 (change log)
Previous IDsdre-mir-204
DescriptionDanio rerio miR-204-1 stem-loop
Gene family MIPF0000042; mir-204
Literature search

4 open access papers mention dre-mir-204-1
(18 sentences)

   ---------------ucauguga   gug        uuu   a    ---a   c 
5'                        ccu   gacuuccc   guc uccu    ugc u
                          |||   ||||||||   ||| ||||    ||| g
3'                        gga   cugaaggg   cgg ggga    aug g
   cgcuuacuacugcggacucgcag   -aa        --u   -    gaua   a 
Get sequence
Deep sequencing
139484 reads, 8.36e+03 reads per million, 11 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr5: 25972068-25972160 [+]
OTTDART00000021500 ; trpm3-001; intron 5
ENSDART00000147188 ; trpm3-001; intron 5
ENSDART00000088033 ; trpm3-201; intron 5
Database links

Mature sequence dre-miR-204-5p

Accession MIMAT0001279
Previous IDsdre-miR-204

18 - 


 - 39

Get sequence
Deep sequencing340914 reads, 11 experiments
Evidence experimental; cloned [1]

Mature sequence dre-miR-204-3p

Accession MIMAT0031924

54 - 


 - 75

Get sequence
Deep sequencing53 reads, 3 experiments
Evidence not experimental
Database links


PMID:12624257 "Vertebrate microRNA genes" Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP Science. 299:1540(2003).
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).