Stem-loop sequence dre-mir-203a

AccessionMI0001376 (change log)
Previous IDsdre-mir-203
DescriptionDanio rerio miR-203a stem-loop
Gene family MIPF0000108; mir-203
Literature search

8 open access papers mention dre-mir-203a
(13 sentences)

Stem-loop
   guguuugggucucuucuggucccu     gc         u    g    a     cua 
5'                         cuggu  agugguucu aaca uuca caguu   u
                           |||||  ||||||||| |||| |||| |||||   c
3'                         gacca  ucaccagga uugu aagu guuaa   u
   ------------------------     gu         u    a    -     aac 
Get sequence
Deep sequencing
375829 reads, 2.07e+04 reads per million, 11 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr17: 45808153-45808248 [+]
intergenic
Database links

Mature sequence dre-miR-203a-5p

Accession MIMAT0031923
Sequence

32 - 

agugguucuuaacaguucaacagu

 - 55

Get sequence
Deep sequencing3385 reads, 10 experiments
Evidence not experimental
Database links

Mature sequence dre-miR-203a-3p

Accession MIMAT0001278
Previous IDsdre-miR-203a
Sequence

70 - 

gugaaauguuuaggaccacuug

 - 91

Get sequence
Deep sequencing372442 reads, 11 experiments
Evidence experimental; cloned [1-2]
Database links
Predicted targets

References

1
PMID:12624257 "Vertebrate microRNA genes" Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP Science. 299:1540(2003).
2
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).