Stem-loop sequence dre-mir-199-3

AccessionMI0001375 (change log)
Previous IDsdre-mir-199a-3
DescriptionDanio rerio miR-199-3 stem-loop
Gene family MIPF0000040; mir-199
Literature search

9 open access papers mention dre-mir-199-3
(16 sentences)

Stem-loop
   -------cc    --   c     c       u a      c      ucau  u 
5'          uccc  ccu gccug ccagugu c gacuac uguuca    gc g
            ||||  ||| ||||| ||||||| | |||||| ||||||    ||  
3'          aggg  ggg cggau gguuaca g cugaug acaagu    cg c
   cacacacac    uc   u     u       c c      -      ----  a 
Get sequence
Deep sequencing
93595 reads, 6.8e+03 reads per million, 11 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr3: 47195137-47195234 [-]
sense
OTTDART00000059576 ; si:ch211-286h12.6-001; exon 2
ENSDART00000156709 ; si:ch211-286h12.6-001; exon 2
antisense
OTTDART00000028003 ; dnm2a-002; intron 6
OTTDART00000028002 ; dnm2a-001; intron 14
ENSDART00000131421 ; dnm2a-002; intron 6
ENSDART00000024031 ; dnm2a-001; intron 14
Database links

Mature sequence dre-miR-199-5p

Accession MIMAT0001277
Previous IDsdre-miR-199a;dre-miR-199
Sequence

16 - 

cccaguguucagacuaccuguuc

 - 38

Get sequence
Deep sequencing131161 reads, 11 experiments
Evidence experimental; cloned [1-2]
Database links
Predicted targets

Mature sequence dre-miR-199-3-3p

Accession MIMAT0031922
Sequence

55 - 

acaguaguccgcacauugguu

 - 75

Get sequence
Deep sequencing49857 reads, 11 experiments
Evidence not experimental
Database links

References

1
PMID:12624257 "Vertebrate microRNA genes" Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP Science. 299:1540(2003).
2
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).