Stem-loop sequence dre-mir-199-2

AccessionMI0001374 (change log)
Previous IDsdre-mir-199a-2
DescriptionDanio rerio miR-199-2 stem-loop
Gene family MIPF0000040; mir-199
Literature search

9 open access papers mention dre-mir-199-2
(16 sentences)

Stem-loop
   ggaguuuuuguggacgcccgu  c     c       u        c   u    aau 
5'                      cc gccug ccagugu cagacuac ugu cagg   u
                        || ||||| ||||||| |||||||| ||| ||||    
3'                      gg cggau gguuaca gucugaug aca guuu   a
   ---------------------  u     u       c        -   u    gug 
Get sequence
Deep sequencing
110220 reads, 7.55e+03 reads per million, 11 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr5: 1376773-1376868 [-]
antisense
OTTDART00000039901 ; dnm1a-001; intron 15
ENSDART00000147972 ; dnm1a-001; intron 15
ENSDART00000026535 ; dnm1a-201; intron 15
Database links

Mature sequence dre-miR-199-5p

Accession MIMAT0001277
Previous IDsdre-miR-199a;dre-miR-199
Sequence

30 - 

cccaguguucagacuaccuguuc

 - 52

Get sequence
Deep sequencing131161 reads, 11 experiments
Evidence experimental; cloned [1-2]
Database links
Predicted targets

Mature sequence dre-miR-199-3p

Accession MIMAT0003155
Previous IDsdre-miR-199*
Sequence

68 - 

uacaguagucugcacauugguu

 - 89

Get sequence
Deep sequencing133080 reads, 11 experiments
Evidence experimental; array [3], in-situ [3]
Database links

References

1
PMID:12624257 "Vertebrate microRNA genes" Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP Science. 299:1540(2003).
2
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).
3
PMID:15919954 "MicroRNA expression in zebrafish embryonic development" Wienholds E, Kloosterman WP, Miska E, Alvarez-Saavedra E, Berezikov E, de Bruijn E, Horvitz HR, Kauppinen S, Plasterk RH Science. 309:310-311(2005).