Stem-loop sequence dre-mir-199-1

AccessionMI0001373 (change log)
Previous IDsdre-mir-199a-1
DescriptionDanio rerio miR-199-1 stem-loop
Gene family MIPF0000040; mir-199
Literature search

10 open access papers mention dre-mir-199-1
(17 sentences)

Stem-loop
   u  -   u c   auc       u        c   ---    ga 
5'  cc ugc c guc   ccagugu cagacuac ugu   ucag  u
    || ||| | |||   ||||||| |||||||| |||   ||||  c
3'  gg acg g cag   gguuaca gucugaug aca   gguc  a
   -  u   u u   auu       c        -   ugu    au 
Get sequence
Deep sequencing
110294 reads, 7.55e+03 reads per million, 11 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr20: 14875460-14875546 [+]
antisense
OTTDART00000004875 ; dnm3-001; intron 15
ENSDART00000047039 ; dnm3-201; intron 14
ENSDART00000152641 ; dnm3-001; intron 15
Clustered miRNAs
< 10kb from dre-mir-199-1
dre-mir-199-1chr20: 14875460-14875546 [+]
dre-mir-214chr20: 14877639-14877738 [+]
Database links

Mature sequence dre-miR-199-5p

Accession MIMAT0001277
Previous IDsdre-miR-199a;dre-miR-199
Sequence

15 - 

cccaguguucagacuaccuguuc

 - 37

Get sequence
Deep sequencing131161 reads, 11 experiments
Evidence experimental; cloned [1-2]
Database links
Predicted targets

Mature sequence dre-miR-199-3p

Accession MIMAT0003155
Previous IDsdre-miR-199*
Sequence

53 - 

uacaguagucugcacauugguu

 - 74

Get sequence
Deep sequencing133080 reads, 11 experiments
Evidence experimental; array [3], in-situ [3]
Database links

References

1
PMID:12624257 "Vertebrate microRNA genes" Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP Science. 299:1540(2003).
2
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).
3
PMID:15919954 "MicroRNA expression in zebrafish embryonic development" Wienholds E, Kloosterman WP, Miska E, Alvarez-Saavedra E, Berezikov E, de Bruijn E, Horvitz HR, Kauppinen S, Plasterk RH Science. 309:310-311(2005).