Stem-loop sequence dre-mir-192

AccessionMI0001371 (change log)
DescriptionDanio rerio miR-192 stem-loop
Gene family MIPF0000063; mir-192
Literature search

3 open access papers mention dre-mir-192
(7 sentences)

Stem-loop
   cuaggac       ga  a     -          c    guuug 
5'        acagggu  ug ccuau gaauugacag cagu     c
          |||||||  || ||||| |||||||||| ||||      
3'        ugucccg  ac ggaug cuugacuguc gucg     a
   ------u       uc  c     u          c    accug 
Get sequence
Deep sequencing
3384 reads, 145 reads per million, 11 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr10: 27063354-27063438 [+]
intergenic
KZ114914.1: 88767-88851 [+]
intergenic
KZ115324.1: 286483-286567 [+]
intergenic
Clustered miRNAs
< 10kb from dre-mir-192
dre-mir-194achr10: 27063174-27063257 [+]
dre-mir-192chr10: 27063354-27063438 [+]
Database links

Mature sequence dre-miR-192

Accession MIMAT0001275
Sequence

16 - 

augaccuaugaauugacagcc

 - 36

Get sequence
Deep sequencing3325 reads, 11 experiments
Evidence experimental; PCR [1], cloned [2]
Database links
Predicted targets

References

1
PMID:12624257 "Vertebrate microRNA genes" Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP Science. 299:1540(2003).
2
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).