Stem-loop sequence dre-mir-183

AccessionMI0001369 (change log)
DescriptionDanio rerio miR-183 stem-loop
Gene family MIPF0000066; mir-183
Literature search

13 open access papers mention dre-mir-183
(56 sentences)

Stem-loop
   ---------ga   c        g      --ac     ga        ugaaag 
5'            cuc uguucugu uauggc    uggua  auucacug      c
              ||| |||||||| ||||||    |||||  ||||||||       
3'            gag acgagaca auaccg    accau  uaagugac      a
   gcaccaagaaa   -        a      ggaa     --        uaucac 
Get sequence
Deep sequencing
13302 reads, 600 reads per million, 11 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr4: 15074566-15074663 [+]
intergenic
Clustered miRNAs
< 10kb from dre-mir-183
dre-mir-183chr4: 15074566-15074663 [+]
dre-mir-96chr4: 15074715-15074839 [+]
dre-mir-182chr4: 15075665-15075732 [+]
Database links

Mature sequence dre-miR-183-5p

Accession MIMAT0001273
Previous IDsdre-miR-183
Sequence

16 - 

uauggcacugguagaauucacug

 - 38

Get sequence
Deep sequencing12658 reads, 11 experiments
Evidence experimental; PCR [1], cloned [2]
Database links
Predicted targets

Mature sequence dre-miR-183-3p

Accession MIMAT0031921
Sequence

56 - 

ugaauuaccaaagggccauaa

 - 76

Get sequence
Deep sequencing639 reads, 11 experiments
Evidence not experimental
Database links

References

1
PMID:12624257 "Vertebrate microRNA genes" Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP Science. 299:1540(2003).
2
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).