Stem-loop sequence dre-mir-181b-2

AccessionMI0001367 (change log)
DescriptionDanio rerio miR-181b-2 stem-loop
Gene family MIPF0000007; mir-181
Literature search

12 open access papers mention dre-mir-181b-2
(42 sentences)

Stem-loop
   cuaa  -      auaaa         cu           ---  u 
5'     ug acugca     cauucauug  gucgguggguu   uc a
       || ||||||     |||||||||  |||||||||||   || a
3'     ac uggcgu     guaaguaac  uagucacucaa   ag u
   ---a  g      caaac         --           cac  a 
Get sequence
Deep sequencing
99630 reads, 5.76e+03 reads per million, 11 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr8: 53023679-53023764 [+]
intergenic
Clustered miRNAs
< 10kb from dre-mir-181b-2
dre-mir-181a-2chr8: 53023539-53023617 [+]
dre-mir-181b-2chr8: 53023679-53023764 [+]
Database links

Mature sequence dre-miR-181b-5p

Accession MIMAT0001270
Previous IDsdre-miR-181b
Sequence

16 - 

aacauucauugcugucgguggg

 - 37

Get sequence
Deep sequencing297640 reads, 11 experiments
Evidence experimental; cloned [1-2]

Mature sequence dre-miR-181b-3p

Accession MIMAT0031920
Sequence

54 - 

cucacugaucaaugaaugcaaa

 - 75

Get sequence
Deep sequencing280 reads, 10 experiments
Evidence not experimental
Database links

References

1
PMID:12624257 "Vertebrate microRNA genes" Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP Science. 299:1540(2003).
2
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).