Stem-loop sequence dre-mir-181b-1

AccessionMI0001366 (change log)
DescriptionDanio rerio miR-181b-1 stem-loop
Gene family MIPF0000007; mir-181
Literature search

12 open access papers mention dre-mir-181b-1
(42 sentences)

Stem-loop
   cauguacgcaccuucaguucuucaaa       auca          cug    u     ua  cu 
5'                           ggucaua    acauucauug   ucgg ggguu  gu  u
                             |||||||    ||||||||||   |||| |||||  ||   
3'                           ccggugu    uguaaguaac   aguc cucga  ca  g
   --------------------uuagac       -caa          --a    u     --  au 
Get sequence
Deep sequencing
99479 reads, 5.76e+03 reads per million, 11 experiments
Confidence Annotation confidence: undefined
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr2: 45202223-45202331 [-]
intergenic
KZ115050.1: 34451-34559 [-]
intergenic
Clustered miRNAs
< 10kb from dre-mir-181b-1
dre-mir-181a-5chr2: 45204633-45204716 [-]
dre-mir-181b-1chr2: 45202223-45202331 [-]
Database links

Mature sequence dre-miR-181b-5p

Accession MIMAT0001270
Previous IDsdre-miR-181b
Sequence

37 - 

aacauucauugcugucgguggg

 - 58

Get sequence
Deep sequencing297640 reads, 11 experiments
Evidence experimental; cloned [1-2]

References

1
PMID:12624257 "Vertebrate microRNA genes" Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP Science. 299:1540(2003).
2
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).