Stem-loop sequence dre-mir-10b-1

AccessionMI0001364 (change log)
Previous IDsdre-mir-10b
DescriptionDanio rerio miR-10b-1 stem-loop
Gene family MIPF0000033; mir-10
Literature search

16 open access papers mention dre-mir-10b-1
(189 sentences)

Stem-loop
   gu        a    g     c          ugaaaa 
5'   cuauauau cccu uagaa cgaauuugug      a
     |||||||| |||| ||||| ||||||||||      a
3'   gguauaug gggg aucuu gcuuagacac      u
   cu        a    -     a          uuacaa 
Get sequence
Deep sequencing
511058 reads, 2.97e+04 reads per million, 11 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

The miR-10b sequence described in [1] is offset by 2 nt with respect to that cloned in mouse (MI0000221).

Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr9: 1952956-1953033 [-]
sense
OTTDART00000047316 ; hoxd3a-002; intron 1
OTTDART00000047317 ; si:rp71-78h1.11-001; exon 2
ENSDART00000138730 ; hoxd3a-002; intron 1
ENSDART00000140438 ; si:rp71-78h1.11-001; exon 2
Database links

Mature sequence dre-miR-10b-5p

Accession MIMAT0001268
Previous IDsdre-miR-10b
Sequence

10 - 

uacccuguagaaccgaauuugug

 - 32

Get sequence
Deep sequencing1017976 reads, 11 experiments
Evidence experimental; cloned [1]
Database links
Predicted targets

Mature sequence dre-miR-10b-3p

Accession MIMAT0031919
Sequence

49 - 

acagauucgauucuaggggagu

 - 70

Get sequence
Deep sequencing1916 reads, 11 experiments
Evidence not experimental
Database links

References

1
PMID:12624257 "Vertebrate microRNA genes" Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP Science. 299:1540(2003).
2
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).
3
PMID:16736008 "The zebrafish hoxDb cluster has been reduced to a single microRNA" Woltering JM, Durston AJ Nat Genet. 38:601-602(2006).