Stem-loop sequence dre-mir-10a

Accession MI0001363
Description Danio rerio miR-10a stem-loop
Gene family MIPF0000033; mir-10
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-10_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The miR-10 microRNA precursor is a short non-coding RNA gene involved in gene regulation. It is part of an RNA gene family which contains miR-10, miR-51, miR-57, miR-99 and miR-100. miR-10, miR-99 and miR-100 have now been predicted or experimentally confirmed in a wide range of species. (MIPF0000033, MIPF0000025) mir-51 and mir-57 have currently only been identified in the nematode Caenorhabditis elegans (MIPF0000268, MIPF0000271). microRNAs are transcribed as ~70 nucleotide precursors and subsequently processed by the Dicer enzyme to give a ~22 nucleotide product. In this case the mature sequence comes from the 5' arm of the precursor. The mature products are thought to have regulatory roles through complementarity to mRNA.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
--------uguc     u        a     u   uc          ugaau 
            uguca cuauauau cccug aga  cgaauuugug     a
            ||||| |||||||| ||||| |||  ||||||||||      
            acagu gauguaua ggggu ucu  gcuuaaacgc     u
cgcaacacaaau     u        a     -   gu          ugaca 
Get sequence
Genome context
Coordinates (Zv9) Overlapping transcripts
12: 28705900-28705998 [+]
intergenic
Database links

Mature sequence dre-miR-10a-5p

Accession MIMAT0001267
Previous IDs dre-miR-10a
Sequence

18 - 

uacccuguagauccgaauuugu

 - 39

Get sequence
Evidence experimental; cloned [1-2]
Validated targets

Mature sequence dre-miR-10a-3p

Accession MIMAT0003391
Previous IDs dre-miR-10a*
Sequence

55 - 

caaauucgugucuuggggaaua

 - 76

Get sequence
Evidence experimental; cloned [2]

References

1
PMID:12624257 "Vertebrate microRNA genes" Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP Science. 299:1540(2003).
2
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).