Stem-loop sequence dre-mir-10a

AccessionMI0001363 (change log)
DescriptionDanio rerio miR-10a stem-loop
Gene family MIPF0000033; mir-10
Literature search

18 open access papers mention dre-mir-10a
(188 sentences)

Stem-loop
   --------uguc     u        a     u   uc          ugaau 
5'             uguca cuauauau cccug aga  cgaauuugug     a
               ||||| |||||||| ||||| |||  ||||||||||      
3'             acagu gauguaua ggggu ucu  gcuuaaacgc     u
   cgcaacacaaau     u        a     -   gu          ugaca 
Get sequence
Deep sequencing
479867 reads, 2.82e+04 reads per million, 11 experiments
Confidence Annotation confidence: undefined
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr12: 27134869-27134967 [+]
intergenic
KZ115384.1: 38985-39083 [+]
intergenic
Database links

Mature sequence dre-miR-10a-5p

Accession MIMAT0001267
Previous IDsdre-miR-10a
Sequence

18 - 

uacccuguagauccgaauuugu

 - 39

Get sequence
Deep sequencing478796 reads, 11 experiments
Evidence experimental; cloned [1-2]
Database links
Predicted targets

Mature sequence dre-miR-10a-3p

Accession MIMAT0003391
Previous IDsdre-miR-10a*
Sequence

55 - 

caaauucgugucuuggggaaua

 - 76

Get sequence
Deep sequencing1071 reads, 6 experiments
Evidence experimental; cloned [2]
Database links

References

1
PMID:12624257 "Vertebrate microRNA genes" Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP Science. 299:1540(2003).
2
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).