Stem-loop sequence dre-mir-7a-2

AccessionMI0001362 (change log)
Previous IDsdre-mir-7-2
DescriptionDanio rerio miR-7a-2 stem-loop
Gene family MIPF0000022; mir-7
Literature search

13 open access papers mention dre-mir-7a-2
(102 sentences)

Stem-loop
   ----------      g    au  a     a       u      gug  gu 
5'           uuuugg cauu  gg agacu gugauuu guuguu   ac  c
             |||||| ||||  || ||||| ||||||| ||||||   ||  a
3'           aagacc guga  cc ucuga cacugaa caacag   ug  u
   cugcucaccu      a    cu  g     -       -      uca  ac 
Get sequence
Deep sequencing
3602 reads, 118 reads per million, 11 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr7: 14450524-14450620 [-]
intergenic
Database links

Mature sequence dre-miR-7a

Accession MIMAT0001266
Previous IDsdre-miR-7
Sequence

13 - 

uggaagacuagugauuuuguugu

 - 35

Get sequence
Deep sequencing10824 reads, 11 experiments
Evidence experimental; cloned [1]
Database links
Predicted targets

References

1
PMID:12624257 "Vertebrate microRNA genes" Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP Science. 299:1540(2003).