Stem-loop sequence dre-mir-7a-1

AccessionMI0001361 (change log)
Previous IDsdre-mir-7-1
DescriptionDanio rerio miR-7a-1 stem-loop
Gene family MIPF0000022; mir-7
Literature search

13 open access papers mention dre-mir-7a-1
(102 sentences)

Stem-loop
   -------------  u  a     a       u      guuucuu 
5'              ug gg agacu gugauuu guuguu       c
                || || ||||| ||||||| ||||||        
3'              ac cc ucuga cacugaa caacag       u
   ucccgggcgagcg  u  a     -       -      ucuuucg 
Get sequence
Deep sequencing
3695 reads, 118 reads per million, 11 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr25: 12472467-12472545 [+]
intergenic
Database links

Mature sequence dre-miR-7a

Accession MIMAT0001266
Previous IDsdre-miR-7
Sequence

3 - 

uggaagacuagugauuuuguugu

 - 25

Get sequence
Deep sequencing10824 reads, 11 experiments
Evidence experimental; cloned [1]
Database links
Predicted targets

References

1
PMID:12624257 "Vertebrate microRNA genes" Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP Science. 299:1540(2003).