Stem-loop sequence dre-mir-7b

AccessionMI0001360 (change log)
DescriptionDanio rerio miR-7b stem-loop
Gene family MIPF0000022; mir-7
Literature search

13 open access papers mention dre-mir-7b
(106 sentences)

Stem-loop
   ugaac     -    cuu     u  a     u       u     ug  aguu 
5'      gcugg cuug   cugug gg agacu gugauuu guugu  uu    a
        ||||| ||||   ||||| || ||||| ||||||| |||||  ||     
3'      cgacc ggac   gacau cc ucugg cacuaaa caaca  ga    g
   --cua     c    -ac     c  g     -       -     gu  agua 
Get sequence
Deep sequencing
3767 reads, 118 reads per million, 11 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr5: 55607744-55607847 [-]
sense
OTTDART00000040008 ; hnrpkl-002; intron 12
OTTDART00000040007 ; hnrpkl-001; intron 15
ENSDART00000139236 ; hnrpkl-002; intron 12
ENSDART00000005671 ; hnrpkl-201; intron 14
ENSDART00000133156 ; hnrpkl-001; intron 15
Database links

Mature sequence dre-miR-7b

Accession MIMAT0001265
Sequence

23 - 

uggaagacuugugauuuuguu

 - 43

Get sequence
Deep sequencing3707 reads, 11 experiments
Evidence experimental; PCR [1]
Database links
Predicted targets

References

1
PMID:12624257 "Vertebrate microRNA genes" Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP Science. 299:1540(2003).