Stem-loop sequence dps-mir-308

AccessionMI0001353 (change log)
DescriptionDrosophila pseudoobscura miR-308 stem-loop
Gene family MIPF0000171; mir-308
Stem-loop
              u       uuuug      c 
5' cucgcaguaua uuuugug     uugugu u
   ||||||||||| |||||||     |||||| g
3' gagugucauau aggacac     aacgca a
              u       ---ua      a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dpse_r2.26_FB2012_01) Overlapping transcripts
3: 16337007-16337068 [-]
intergenic
Database links

Mature sequence dps-miR-308

Accession MIMAT0001258
Sequence

41 - 

aaucacaggauuauacugugag

 - 62

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20037610 "Evolutionary flux of canonical microRNAs and mirtrons in Drosophila" Berezikov E, Liu N, Flynt AS, Hodges E, Rooks M, Hannon GJ, Lai EC Nat Genet. 42:6-9(2010).