Stem-loop sequence dps-mir-306

AccessionMI0001351 (change log)
DescriptionDrosophila pseudoobscura miR-306 stem-loop
Gene family MIPF0000313; mir-306
Stem-loop
   -    uu     cu       uu  u        --   - u 
5'  cacu  gccgg  cagguac  ag gacucuca  aug c u
    ||||  |||||  |||||||  || ||||||||  ||| |  
3'  gugg  cgguc  guccgug  uc cugagagu  uac g u
   g    --     ac       uc  u        uc   a c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dpse_r2.26_FB2012_01) Overlapping transcripts
4_group3: 8443820-8443899 [+]
intergenic
Clustered miRNAs
< 10kb from dps-mir-306
dps-mir-9c4_group3: 8443195-8443286 [+]
dps-mir-3064_group3: 8443820-8443899 [+]
dps-mir-794_group3: 8443999-8444082 [+]
dps-mir-9b4_group3: 8444194-8444284 [+]
Database links

Mature sequence dps-miR-306

Accession MIMAT0001256
Sequence

13 - 

ucagguacuuagugacucucaa

 - 34

Get sequence
Evidence by similarity; MI0000414, MI0000414