Stem-loop sequence dps-mir-281-2

AccessionMI0001340 (change log)
DescriptionDrosophila pseudoobscura miR-281-2 stem-loop
Gene family MIPF0000087; mir-46
Stem-loop
         gug a           -ua     c      ---ca    a 
5' cgaaua   a auaaagagagc   uccgu gacagu     aguu a
   ||||||   | |||||||||||   ||||| ||||||     |||| u
3' gcuuau   u uguuucucucg   aggua cuguca     uuag c
         -aa a           uua     -      uaaug    a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dpse_r2.26_FB2012_01) Overlapping transcripts
3: 418220-418310 [-]
intergenic
Clustered miRNAs
< 10kb from dps-mir-281-2
dps-mir-281-13: 418424-418511 [-]
dps-mir-281-23: 418220-418310 [-]
Database links

Mature sequence dps-miR-281

Accession MIMAT0001245
Sequence

59 - 

ugucauggaauugcucucuuugu

 - 81

Get sequence
Evidence by similarity; MI0000370, MI0000370