Stem-loop sequence dps-mir-281-1

AccessionMI0001339 (change log)
DescriptionDrosophila pseudoobscura miR-281-1 stem-loop
Gene family MIPF0000087; mir-46
Stem-loop
         gg  a           -ug     c      caacgua 
5' cgaaua  ug auaaagagagc   uccgu gacagu       c
   ||||||  || |||||||||||   ||||| ||||||       c
3' gcuuau  au uguuucucucg   aggua cuguca       a
         -a  a           uua     -      uaauuua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dpse_r2.26_FB2012_01) Overlapping transcripts
3: 418424-418511 [-]
intergenic
Clustered miRNAs
< 10kb from dps-mir-281-1
dps-mir-281-13: 418424-418511 [-]
dps-mir-281-23: 418220-418310 [-]
Database links

Mature sequence dps-miR-281

Accession MIMAT0001245
Sequence

56 - 

ugucauggaauugcucucuuugu

 - 78

Get sequence
Evidence by similarity; MI0000370, MI0000370