Stem-loop sequence dps-mir-210a

AccessionMI0001327 (change log)
Previous IDsdps-mir-210
DescriptionDrosophila pseudoobscura miR-210a stem-loop
Gene family MIPF0000086; mir-210
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled Mir-210_microRNA. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

In molecular biology mir-210 microRNA is a short RNA molecule. MicroRNAs function to regulate the expression levels of other genes by several mechanisms. mir-210 has been strongly linked with the hypoxia pathway, and is upregulated in response to Hypoxia-inducible factors. It is also overexpressed in cells affected by cardiac disease and tumours. MiRNA-210 in particular, has been studied for its effects in rescuing cardiac function after myocardial infarcts via the up-regulation of angiogenesis and inhibition of cardiomyocyte apoptosis.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   ------------   -a     ugc        gc   -         uuaga 
5'             ggu  cuuau   agcugcug  cac ugcacaaga     u
               |||  |||||   ||||||||  ||| |||||||||     u
3'             ccg  gaaug   ucggcgac  gug gcguguucu     u
   acuacgauuaua   ga     uua        -a   u         cagaa 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dpse_r2.26_FB2012_01) Overlapping transcripts
XL_group3a: 1970510-1970603 [-]
intergenic
Clustered miRNAs
< 10kb from dps-mir-210a
dps-mir-969XL_group3a: 1977493-1977604 [-]
dps-mir-210bXL_group3a: 1970510-1970618 [+]
dps-mir-210aXL_group3a: 1970510-1970603 [-]
Database links

Mature sequence dps-miR-210a

Accession MIMAT0001233
Previous IDsdps-miR-210
Sequence

50 - 

uugugcgugugacagcggcua

 - 70

Get sequence
Evidence by similarity; MI0000376