Stem-loop sequence dps-mir-210a

AccessionMI0001327 (change log)
Previous IDsdps-mir-210
DescriptionDrosophila pseudoobscura miR-210a stem-loop
Gene family MIPF0000086; mir-210
Stem-loop
   ------------   -a     ugc        gc   -         uuaga 
5'             ggu  cuuau   agcugcug  cac ugcacaaga     u
               |||  |||||   ||||||||  ||| |||||||||     u
3'             ccg  gaaug   ucggcgac  gug gcguguucu     u
   acuacgauuaua   ga     uua        -a   u         cagaa 
Get sequence
Confidence Annotation confidence: undefined
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dpse_r2.26_FB2012_01) Overlapping transcripts
XL_group3a: 1970510-1970603 [-]
intergenic
Clustered miRNAs
< 10kb from dps-mir-210a
dps-mir-969XL_group3a: 1977493-1977604 [-]
dps-mir-210bXL_group3a: 1970510-1970618 [+]
dps-mir-210aXL_group3a: 1970510-1970603 [-]
Database links

Mature sequence dps-miR-210a

Accession MIMAT0001233
Previous IDsdps-miR-210
Sequence

50 - 

uugugcgugugacagcggcua

 - 70

Get sequence
Evidence by similarity; MI0000376