Stem-loop sequence dps-mir-79

AccessionMI0001318 (change log)
DescriptionDrosophila pseudoobscura miR-79 stem-loop
Gene family MIPF0000014; mir-9
Literature search

1 open access papers mention dps-mir-79
(1 sentences)

Stem-loop
   cugcucu   uc        cgc       g     uag  u 
5'        gcu  ugcuuugg   uuuagcu uauga   au u
          |||  ||||||||   ||||||| |||||   || a
3'        cgg  acgaaacc   agaucga auacu   ua a
   ---gucu   uu        auu       a     uca  a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dpse_r2.26_FB2012_01) Overlapping transcripts
4_group3: 8443999-8444082 [+]
intergenic
Clustered miRNAs
< 10kb from dps-mir-79
dps-mir-9c4_group3: 8443195-8443286 [+]
dps-mir-3064_group3: 8443820-8443899 [+]
dps-mir-794_group3: 8443999-8444082 [+]
dps-mir-9b4_group3: 8444194-8444284 [+]
Database links

Mature sequence dps-miR-79

Accession MIMAT0001224
Sequence

55 - 

uaaagcuagauuaccaaagcau

 - 76

Get sequence
Evidence by similarity; MI0000374, MI0000374