Stem-loop sequence dps-mir-11

AccessionMI0001308 (change log)
DescriptionDrosophila pseudoobscura miR-11 stem-loop
Gene family MIPF0000252; mir-11
Stem-loop
   --   uu u          uu      cc  c  gac 
5'   cuc  g caagaacuua  cuguga  ug gu   a
     |||  | ||||||||||  ||||||  || ||    
3'   gag  c guucuugagu  gacacu  ac cg   u
   gc   -u -          cu      ac  -  auu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dpse_r2.26_FB2012_01) Overlapping transcripts
2: 23857563-23857633 [-]
intergenic
Database links

Mature sequence dps-miR-11

Accession MIMAT0001215
Sequence

45 - 

caucacagucugaguucuugc

 - 65

Get sequence
Evidence by similarity; MI0000131, MI0000131