Stem-loop sequence dps-mir-9c

AccessionMI0001306 (change log)
DescriptionDrosophila pseudoobscura miR-9c stem-loop
Gene family MIPF0000014; mir-9
Stem-loop
       uu    uuu         ucu    g     u  uuuu   a 
5' auuu  gcug   cuuugguau   agcu uagau gu    ugc c
   ||||  ||||   |||||||||   |||| ||||| ||    ||| a
3' uaaa  cgac   gaaaccaua   ucga aucua ua    aug u
       uu    cuc         uuu    a     c  ---u   u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dpse_r2.26_FB2012_01) Overlapping transcripts
4_group3: 8443195-8443286 [+]
intergenic
Clustered miRNAs
< 10kb from dps-mir-9c
dps-mir-9c4_group3: 8443195-8443286 [+]
dps-mir-3064_group3: 8443820-8443899 [+]
dps-mir-794_group3: 8443999-8444082 [+]
dps-mir-9b4_group3: 8444194-8444284 [+]
Database links

Mature sequence dps-miR-9c

Accession MIMAT0001213
Sequence

13 - 

ucuuugguauucuagcuguaga

 - 34

Get sequence
Evidence by similarity; MI0000413, MI0000413