Stem-loop sequence gga-mir-196-3

AccessionMI0001282 (change log)
DescriptionGallus gallus miR-196-3 stem-loop
Gene family MIPF0000031; mir-196
Literature search

6 open access papers mention gga-mir-196-3
(9 sentences)

Stem-loop
   --------uuucaugc       cu      u          a          a   g 
5'                 agcugau  gugguu agguaguuuc uguuguuggg uug c
                   |||||||  |||||| |||||||||| |||||||||| ||| u
3'                 uugacug  cauuaa uccgucaaag acaacggcuc gau u
   cgggaacuacuucuga       --      u          a          -   u 
Get sequence
Deep sequencing
205067 reads, 2.46e+03 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr33: 1025337-1025444 [+]
intergenic
Database links

Mature sequence gga-miR-196-5p

Accession MIMAT0001121
Sequence

24 - 

uagguaguuucauguuguugg

 - 44

Get sequence
Deep sequencing1021521 reads, 5 experiments
Evidence experimental; cloned [2]
Database links
Predicted targets

References

1
PMID:15592404 "Sequence and comparative analysis of the chicken genome provide unique perspectives on vertebrate evolution" International Chicken Genome Sequencing Consortium Nature. 432:695-716(2004).
2
" McBride D, Carre W, Law A, Clinton M Unpublished.