Stem-loop sequence gga-mir-7b

AccessionMI0001279 (change log)
Previous IDsgga-mir-7b-1
DescriptionGallus gallus miR-7b stem-loop
Gene family MIPF0000022; mir-7
Literature search

12 open access papers mention gga-mir-7b
(155 sentences)

Stem-loop
   ------u  a   u     a  u        a     a      uu       --     a 
5'        gg cau ggucu gu cugugugg agacu gugauu  uguuguu  uuuag u
          || ||| ||||| || |||||||| ||||| ||||||  |||||||  |||||  
3'        cc gua ucaga ca gguauacc ucuga cacuaa  acaacag  aaauc a
   gacaucu  -   -     -  c        a     -      --       uu     a 
Get sequence
Deep sequencing
2480 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chrW: 3067226-3067335 [-]
intergenic
Database links

Mature sequence gga-miR-7b

Accession MIMAT0001192
Sequence

23 - 

uggaagacuagugauuuuuguu

 - 44

Get sequence
Deep sequencing2140 reads, 5 experiments
Evidence experimental; cloned [2]
Predicted targets

References

1
PMID:15592404 "Sequence and comparative analysis of the chicken genome provide unique perspectives on vertebrate evolution" International Chicken Genome Sequencing Consortium Nature. 432:695-716(2004).
2
" McBride D, Carre W, Law A, Clinton M Unpublished.