Stem-loop sequence gga-mir-7b

Accession MI0001279
Previous IDs gga-mir-7b-1
Description Gallus gallus miR-7b stem-loop
Gene family MIPF0000022; mir-7
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-7_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

This family represents the microRNA (miRNA) precursor mir-7. This miRNA has been predicted or experimentally confirmed in a wide range of species. miRNAs are transcribed as ~70 nucleotide precursors (modelled here) and subsequently processed by the Dicer enzyme to give a ~22 nucleotide product. In this case the mature sequence comes from the 5' arm of the precursor. The extents of the hairpin precursors are not generally known and are estimated based on hairpin prediction. The involvement of Dicer in miRNA processing suggests a relationship with the phenomenon of RNA interference. Mature miRNA-7 is derived from three microRNA precursors in the human genome, miR-7-1, miR-7-2 and miR-7-3. miRNAs are numbered based on the sequence of the mature RNA. miR-7 is directly regulated by the transcription factor HoxD10. miRNAs are thought to have regulatory roles through complementarity to mRNA. miR-7 is essential for the maintenance of regulatory stability under conditions of environmental flux. It plays an important role in controlling mRNA expression. The miR-7 gene is found in most sequenced Urbilateria species, and the sequence of its mature miRNA product is perfectly conserved from annelids to humans, indicating a strong functional conservation.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
------u  a   u     a  u        a     a      uu       --     a 
       gg cau ggucu gu cugugugg agacu gugauu  uguuguu  uuuag u
       || ||| ||||| || |||||||| ||||| ||||||  |||||||  |||||  
       cc gua ucaga ca gguauacc ucuga cacuaa  acaacag  aaauc a
gacaucu  -   -     -  c        a     -      --       uu     a 
Get sequence
Genome context
Coordinates (Gallus-gallus-4.0) Overlapping transcripts
gb|JH376210.1|: 32418-32527 [+]
intergenic
Database links

Mature sequence gga-miR-7b

Accession MIMAT0001192
Sequence

23 - 

uggaagacuagugauuuuuguu

 - 44

Get sequence
Evidence experimental; cloned [2]
Predicted targets

References

1
PMID:15592404 "Sequence and comparative analysis of the chicken genome provide unique perspectives on vertebrate evolution" International Chicken Genome Sequencing Consortium Nature. 432:695-716(2004).
2
" McBride D, Carre W, Law A, Clinton M Unpublished.