Stem-loop sequence gga-mir-183

AccessionMI0001278 (change log)
DescriptionGallus gallus miR-183 stem-loop
Gene family MIPF0000066; mir-183
Literature search

8 open access papers mention gga-mir-183
(115 sentences)

Stem-loop
   -----------a   c        g      --ac     ga        --   aa 
5'             cuc uguucugu uauggc    uggua  auucacug  ugc  c
               ||| |||||||| ||||||    |||||  ||||||||  |||   
3'             gag acgagaca auaccg    accau  uaagugac  gcg  c
   agcgcccagaaa   -        a      ggau     --        ug   cc 
Get sequence
Deep sequencing
9119 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This sequence is a predicted homologue of a verified miRNA from human, mouse or rat. Its expression has not been validated in chicken.

Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr1: 844362-844459 [-]
intergenic
Clustered miRNAs
< 10kb from gga-mir-183
gga-mir-183chr1: 844362-844459 [-]
gga-mir-96chr1: 844251-844336 [-]
gga-mir-182chr1: 843232-843313 [-]
Database links

Mature sequence gga-miR-183

Accession MIMAT0001191
Sequence

15 - 

uauggcacugguagaauucacug

 - 37

Get sequence
Deep sequencing9113 reads, 5 experiments
Evidence by similarity; MI0000928
Predicted targets

References

1
PMID:15592404 "Sequence and comparative analysis of the chicken genome provide unique perspectives on vertebrate evolution" International Chicken Genome Sequencing Consortium Nature. 432:695-716(2004).