Stem-loop sequence gga-mir-122-1

AccessionMI0001277 (change log)
Previous IDsgga-mir-122a-1
DescriptionGallus gallus miR-122-1 stem-loop
Gene family MIPF0000095; mir-122
Literature search

17 open access papers mention gga-mir-122-1
(86 sentences)

Stem-loop
   ----   -      gg       c           ugucc 
5'     cag agcugu  aguguga aaugguguuug     a
       ||| ||||||  ||||||| |||||||||||      
3'     guc ucgaua  ucacacu uuaccgcaaac     a
   gaug   a      aa       a           uaucu 
Get sequence
Deep sequencing
69166 reads, 760 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chrZ: 761121-761197 [+]
intergenic
Clustered miRNAs
< 10kb from gga-mir-122-1
gga-mir-122-1chrZ: 761121-761197 [+]
gga-mir-12294chrZ: 768922-768982 [+]
Database links

Mature sequence gga-miR-122-5p

Accession MIMAT0001190
Previous IDsgga-miR-122a
Sequence

9 - 

uggagugugacaaugguguuugu

 - 31

Get sequence
Deep sequencing138240 reads, 5 experiments
Evidence experimental; cloned [2], Northern [2], Illumina [3]
Database links
Predicted targets

Mature sequence gga-miR-122-3p

Accession MIMAT0026550
Sequence

45 - 

aacgccauuaucacacuaaaua

 - 66

Get sequence
Deep sequencing92 reads, 2 experiments
Evidence experimental; Illumina [3]
Predicted targets

References

1
PMID:15592404 "Sequence and comparative analysis of the chicken genome provide unique perspectives on vertebrate evolution" International Chicken Genome Sequencing Consortium Nature. 432:695-716(2004).
2
PMID:16750530 "Identification of microRNAs from different tissues of chicken embryo and adult chicken" Xu H, Wang X, Du Z, Li N FEBS Lett. 580:3610-3616(2006).
3
" McBride D, Carre W, Law A, Clinton M Unpublished.
4
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).