Stem-loop sequence gga-mir-31

AccessionMI0001276 (change log)
DescriptionGallus gallus miR-31 stem-loop
Gene family MIPF0000064; mir-31
Literature search

12 open access papers mention gga-mir-31
(52 sentences)

Stem-loop
   uucuuucaug    g u      ga     g             -u   aac 
5'           caga c ggaggg  ggcaa auguuggcauagc  guu   c
             |||| | ||||||  ||||| |||||||||||||  |||    
3'           gucu g ccuuuc  cuguu uacaaccguaucg  caa   u
   ----------    - u      ua     a             uc   aaa 
Get sequence
Deep sequencing
1700 reads, 80 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chrZ: 78512252-78512345 [-]
intergenic
Database links

Mature sequence gga-miR-31-5p

Accession MIMAT0001189
Sequence

25 - 

aggcaagauguuggcauagcug

 - 46

Get sequence
Deep sequencing1655 reads, 5 experiments
Evidence experimental; Illumina [2]
Predicted targets

Mature sequence gga-miR-31-3p

Accession MIMAT0026549
Sequence

61 - 

ugcuaugccaacauauugucauc

 - 83

Get sequence
Deep sequencing45 reads, 4 experiments
Evidence experimental; Illumina [2]
Predicted targets

References

1
PMID:15592404 "Sequence and comparative analysis of the chicken genome provide unique perspectives on vertebrate evolution" International Chicken Genome Sequencing Consortium Nature. 432:695-716(2004).
2
" McBride D, Carre W, Law A, Clinton M Unpublished.
3
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).