Stem-loop sequence gga-mir-24

AccessionMI0001275 (change log)
DescriptionGallus gallus miR-24 stem-loop
Gene family MIPF0000041; mir-24
Literature search

10 open access papers mention gga-mir-24
(16 sentences)

Stem-loop
       g  g   a         ua     uc  au 
5' cucc gu ccu cugagcuga  ucagu  ug  u
   |||| || ||| |||||||||  |||||  ||   
3' gagg ca gga gacuugacu  gguca  ac  u
       a  a   c         -c     -u  au 
Get sequence
Deep sequencing
375373 reads, 4e+03 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chrZ: 41649935-41650002 [+]
intergenic
Clustered miRNAs
< 10kb from gga-mir-24
gga-mir-23bchrZ: 41649166-41649251 [+]
gga-mir-27bchrZ: 41649402-41649498 [+]
gga-mir-24chrZ: 41649935-41650002 [+]
Database links

Mature sequence gga-miR-24-5p

Accession MIMAT0026548
Sequence

6 - 

gugccuacugagcugauaucagu

 - 28

Get sequence
Deep sequencing132 reads, 5 experiments
Evidence experimental; Illumina [3]
Predicted targets

Mature sequence gga-miR-24-3p

Accession MIMAT0001188
Sequence

44 - 

uggcucaguucagcaggaacag

 - 65

Get sequence
Deep sequencing375240 reads, 5 experiments
Evidence experimental; cloned [2], Illumina [3]
Database links
Predicted targets

References

1
PMID:15592404 "Sequence and comparative analysis of the chicken genome provide unique perspectives on vertebrate evolution" International Chicken Genome Sequencing Consortium Nature. 432:695-716(2004).
2
PMID:18256158 "MicroRNA profile of Marek's disease virus-transformed T-cell line MSB-1: predominance of virus-encoded microRNAs" Yao Y, Zhao Y, Xu H, Smith LP, Lawrie CH, Watson M, Nair V J Virol. 82:4007-4015(2008).
3
" McBride D, Carre W, Law A, Clinton M Unpublished.
4
PMID:18256158 "MicroRNA profile of Marek's disease virus-transformed T-cell line MSB-1: predominance of virus-encoded microRNAs" Yao Y, Zhao Y, Xu H, Smith LP, Lawrie CH, Watson M, Nair V J Virol. 82:4007-4015(2008).
5
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).