Stem-loop sequence gga-mir-27b

AccessionMI0001274 (change log)
DescriptionGallus gallus miR-27b stem-loop
Gene family MIPF0000036; mir-27
Literature search

17 open access papers mention gga-mir-27b
(35 sentences)

Stem-loop
   -    -    ggug                  auug        u  uug 
5'  accu cucu    aggugcagagcuuagcug    gugaacag ga   u
    |||| ||||    ||||||||||||||||||    |||||||| ||   u
3'  ugga gaga    uccacgucuugaaucggu    cacuuguu cu   u
   g    a    --ag                  --ga        u  ccc 
Get sequence
Deep sequencing
217162 reads, 2.32e+03 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chrZ: 41649402-41649498 [+]
intergenic
Clustered miRNAs
< 10kb from gga-mir-27b
gga-mir-23bchrZ: 41649166-41649251 [+]
gga-mir-27bchrZ: 41649402-41649498 [+]
gga-mir-24chrZ: 41649935-41650002 [+]
Database links

Mature sequence gga-miR-27b-5p

Accession MIMAT0026547
Sequence

19 - 

agagcuuagcugauuggugaaca

 - 41

Get sequence
Deep sequencing4374 reads, 5 experiments
Evidence experimental; Illumina [3]
Database links
Predicted targets

Mature sequence gga-miR-27b-3p

Accession MIMAT0001187
Sequence

61 - 

uucacaguggcuaaguucugc

 - 81

Get sequence
Deep sequencing212783 reads, 5 experiments
Evidence experimental; cloned [2], Illumina [3]
Database links
Predicted targets

References

1
PMID:15592404 "Sequence and comparative analysis of the chicken genome provide unique perspectives on vertebrate evolution" International Chicken Genome Sequencing Consortium Nature. 432:695-716(2004).
2
PMID:18256158 "MicroRNA profile of Marek's disease virus-transformed T-cell line MSB-1: predominance of virus-encoded microRNAs" Yao Y, Zhao Y, Xu H, Smith LP, Lawrie CH, Watson M, Nair V J Virol. 82:4007-4015(2008).
3
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).