Stem-loop sequence gga-mir-23b

AccessionMI0001273 (change log)
DescriptionGallus gallus miR-23b stem-loop
Gene family MIPF0000027; mir-23
Literature search

13 open access papers mention gga-mir-23b
(78 sentences)

Stem-loop
   u  ug       u   --          -  a      gug   u 
5'  gu  uggcugu ugg  guuccuggca ug ugauuu   agu a
    ||  ||||||| |||  |||||||||| || ||||||   |||  
3'  ca  accgaua acc  uagggaccgu ac acuaaa   uua a
   c  gu       c   au          u  -      --a   g 
Get sequence
Deep sequencing
71490 reads, 640 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chrZ: 41649166-41649251 [+]
intergenic
Clustered miRNAs
< 10kb from gga-mir-23b
gga-mir-23bchrZ: 41649166-41649251 [+]
gga-mir-27bchrZ: 41649402-41649498 [+]
gga-mir-24chrZ: 41649935-41650002 [+]
Database links

Mature sequence gga-miR-23b-5p

Accession MIMAT0026546
Sequence

15 - 

ggguuccuggcaugaugauuu

 - 35

Get sequence
Deep sequencing40 reads, 4 experiments
Evidence experimental; Illumina [3]
Predicted targets

Mature sequence gga-miR-23b-3p

Accession MIMAT0001186
Sequence

52 - 

aucacauugccagggauuacc

 - 72

Get sequence
Deep sequencing71447 reads, 5 experiments
Evidence experimental; cloned [2], Illumina [3]
Database links
Predicted targets

References

1
PMID:15592404 "Sequence and comparative analysis of the chicken genome provide unique perspectives on vertebrate evolution" International Chicken Genome Sequencing Consortium Nature. 432:695-716(2004).
2
PMID:18256158 "MicroRNA profile of Marek's disease virus-transformed T-cell line MSB-1: predominance of virus-encoded microRNAs" Yao Y, Zhao Y, Xu H, Smith LP, Lawrie CH, Watson M, Nair V J Virol. 82:4007-4015(2008).
3
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).