Stem-loop sequence gga-mir-7-1

AccessionMI0001272 (change log)
DescriptionGallus gallus miR-7-1 stem-loop
Gene family MIPF0000022; mir-7
Literature search

11 open access papers mention gga-mir-7-1
(155 sentences)

Stem-loop
   ---    u  -      a  u        a     a       u      --     a 
5'    ugga gu uggucu gu cugugugg agacu gugauuu guuguu  uuuag u
      |||| || |||||| || |||||||| ||||| ||||||| ||||||  |||||  
3'    aucu cg acuaga ca gguauacc ucuga cacuaaa caacag  aaauu a
   gac    c  u      -  c        g     -       -      uu     a 
Get sequence
Deep sequencing
44723 reads, 320 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chrZ: 40078117-40078225 [-]
sense
Database links

Mature sequence gga-miR-7

Accession MIMAT0001157
Sequence

23 - 

uggaagacuagugauuuuguug

 - 44

Get sequence
Deep sequencing132586 reads, 5 experiments
Evidence experimental; cloned [2]
Database links
Predicted targets

References

1
PMID:15592404 "Sequence and comparative analysis of the chicken genome provide unique perspectives on vertebrate evolution" International Chicken Genome Sequencing Consortium Nature. 432:695-716(2004).
2
PMID:18256158 "MicroRNA profile of Marek's disease virus-transformed T-cell line MSB-1: predominance of virus-encoded microRNAs" Yao Y, Zhao Y, Xu H, Smith LP, Lawrie CH, Watson M, Nair V J Virol. 82:4007-4015(2008).
3
" McBride D, Carre W, Law A, Clinton M Unpublished.
4
PMID:18256158 "MicroRNA profile of Marek's disease virus-transformed T-cell line MSB-1: predominance of virus-encoded microRNAs" Yao Y, Zhao Y, Xu H, Smith LP, Lawrie CH, Watson M, Nair V J Virol. 82:4007-4015(2008).