Stem-loop sequence gga-mir-7-3

AccessionMI0001269 (change log)
DescriptionGallus gallus miR-7-3 stem-loop
Gene family MIPF0000022; mir-7
Literature search

10 open access papers mention gga-mir-7-3
(155 sentences)

Stem-loop
   cugu      gcu        a  a   g      u        gauu 
5'     ggucug   cugugugg ag cua ugauuu guuguuau    u
       ||||||   |||||||| || ||| |||||| ||||||||    a
3'     cuagac   gacauacc uc gau acuaaa caacagug    u
   -cuu      -ac        g  c   -      -        gaaa 
Get sequence
Deep sequencing
44247 reads, 320 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr28: 4892799-4892893 [-]
intergenic
Database links

Mature sequence gga-miR-7

Accession MIMAT0001157
Sequence

19 - 

uggaagacuagugauuuuguug

 - 40

Get sequence
Deep sequencing132586 reads, 5 experiments
Evidence experimental; cloned [2]
Database links
Predicted targets

References

1
" McBride D, Carre W, Law A, Clinton M Unpublished.
2
PMID:18463306 "Conservation of small RNA pathways in platypus" Murchison EP, Kheradpour P, Sachidanandam R, Smith C, Hodges E, Xuan Z, Kellis M, Grutzner F, Stark A, Hannon GJ Genome Res. 18:995-1004(2008).
3
PMID:18256158 "MicroRNA profile of Marek's disease virus-transformed T-cell line MSB-1: predominance of virus-encoded microRNAs" Yao Y, Zhao Y, Xu H, Smith LP, Lawrie CH, Watson M, Nair V J Virol. 82:4007-4015(2008).
4
PMID:18463306 "Conservation of small RNA pathways in platypus" Murchison EP, Kheradpour P, Sachidanandam R, Smith C, Hodges E, Xuan Z, Kellis M, Grutzner F, Stark A, Hannon GJ Genome Res. 18:995-1004(2008).
5
PMID:18256158 "MicroRNA profile of Marek's disease virus-transformed T-cell line MSB-1: predominance of virus-encoded microRNAs" Yao Y, Zhao Y, Xu H, Smith LP, Lawrie CH, Watson M, Nair V J Virol. 82:4007-4015(2008).