|
miRBase |
|
Stem-loop sequence MI0001269 |
|||||
| Accession | MI0001269 | ||||
| ID | gga-mir-7-3 | ||||
| Description | Gallus gallus miR-7-3 stem-loop | ||||
| Stem-loop |
cugu gcu a a g u gauu ggucug cugugugg ag cua ugauuu guuguuau u |||||| |||||||| || ||| |||||| |||||||| a cuagac gacauacc uc gau acuaaa caacagug u -cuu -ac g c - - gaaa |
||||
| Genome context |
|
||||
| Database links |
|
||||
| Gene family |
MIPF0000022; mir-7 |
||||
Mature sequence MIMAT0001157 |
|
| Accession | MIMAT0001157 |
| ID | gga-miR-7 |
| Sequence |
19 - uggaagacuagugauuuuguug - 40 |
| Evidence | experimental; cloned [1-3] |
| Predicted targets | |
References |
|
| 1 |
Unpublished.
|
| 2 |
"Conservation of small RNA pathways in platypus"
Genome Res. 18:995-1004(2008).
|
| 3 |
"MicroRNA profile of Marek's disease virus-transformed T-cell line MSB-1: predominance of virus-encoded microRNAs"
J Virol. 82:4007-4015(2008).
|