Stem-loop sequence gga-mir-29b-2

AccessionMI0001266 (change log)
DescriptionGallus gallus miR-29b-2 stem-loop
Gene family MIPF0000009; mir-29
Literature search

14 open access papers mention gga-mir-29b-2
(55 sentences)

Stem-loop
   cc       -          c      g  u    uuucc 
5'   ucuggaa gcugguuuca auggug cu agau     c
     ||||||| |||||||||| |||||| || ||||     a
3'   ggaucuu ugacuaaagu uaccac ga ucua     c
   ga       g          u      -  -    uguuu 
Get sequence
Deep sequencing
71990 reads, 660 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr26: 2699722-2699801 [-]
intergenic
Clustered miRNAs
< 10kb from gga-mir-29b-2
gga-mir-29b-2chr26: 2699722-2699801 [-]
gga-mir-29cchr26: 2698811-2698899 [-]
Database links

Mature sequence gga-miR-29b-2-5p

Accession MIMAT0031072
Sequence

9 - 

agcugguuucacaugguggcuuaga

 - 33

Get sequence
Deep sequencing2402 reads, 5 experiments
Evidence experimental; Illumina [3]
Predicted targets

Mature sequence gga-miR-29b-3p

Accession MIMAT0001097
Sequence

51 - 

uagcaccauuugaaaucaguguu

 - 73

Get sequence
Deep sequencing139071 reads, 5 experiments
Evidence experimental; cloned [2], Illumina [3]
Database links
Predicted targets

References

1
PMID:15592404 "Sequence and comparative analysis of the chicken genome provide unique perspectives on vertebrate evolution" International Chicken Genome Sequencing Consortium Nature. 432:695-716(2004).
2
PMID:18256158 "MicroRNA profile of Marek's disease virus-transformed T-cell line MSB-1: predominance of virus-encoded microRNAs" Yao Y, Zhao Y, Xu H, Smith LP, Lawrie CH, Watson M, Nair V J Virol. 82:4007-4015(2008).
3
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).