Stem-loop sequence gga-mir-29c

AccessionMI0001265 (change log)
DescriptionGallus gallus miR-29c stem-loop
Gene family MIPF0000009; mir-29
Literature search

11 open access papers mention gga-mir-29c
(24 sentences)

Stem-loop
   -         -  ggc           ucu       ---     uc 
5'  ucucuuaca ca   ugaccgauuuc   ugguguu   cagag  u
    ||||||||| ||   |||||||||||   |||||||   |||||  c
3'  gggggaugu gu   auuggcuaaag   accacga   gucuu  a
   a         a  ---           uuu       ucu     ug 
Get sequence
Deep sequencing
71640 reads, 660 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr26: 2698811-2698899 [-]
intergenic
Clustered miRNAs
< 10kb from gga-mir-29c
gga-mir-29b-2chr26: 2699722-2699801 [-]
gga-mir-29cchr26: 2698811-2698899 [-]
Database links

Mature sequence gga-miR-29c-5p

Accession MIMAT0026544
Sequence

18 - 

ccgauuucucuugguguucag

 - 38

Get sequence
Deep sequencing871 reads, 5 experiments
Evidence experimental; Illumina [2]
Predicted targets

Mature sequence gga-miR-29c-3p

Accession MIMAT0001183
Sequence

55 - 

uagcaccauuugaaaucggu

 - 74

Get sequence
Deep sequencing70759 reads, 5 experiments
Evidence experimental; Illumina [2]
Database links
Predicted targets

References

1
PMID:15592404 "Sequence and comparative analysis of the chicken genome provide unique perspectives on vertebrate evolution" International Chicken Genome Sequencing Consortium Nature. 432:695-716(2004).
2
" McBride D, Carre W, Law A, Clinton M Unpublished.
3
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).